SciBlogs

Confusion and disorder Vic Arcus Mar 01

2 Comments

Confusion and disorder go together in many respects. Politically…. Socially…. disorder and confusion are firm friends. But I would like to speak about disorder from a scientific point of view because in this respect as well, there tends to be confusion. And yet, disorder (or entropy) is one of the most important concepts in science. Peter Atkins (Oxford chemistry professor and author) cites the second law of thermodynamics (which is about disorder) as the reason why everything in the universe happens. And Einstein agrees: “It is the only physical theory of universal content which I am convinced will never be overthrown.”

So it is worthwhile making some attempt to get to grips with disorder (or entropy) whilst avoiding confusion.

We see a tendency for things to become more disordered in our everyday lives. Somehow the house does not stay tidy, nor does my desk. The glass which falls on the concrete shatters into pieces. My car deteriorates with rust and fading paint. It’s natural for things to become disordered. Beautiful snowflakes melt, sugar dissolves in tea. For humans, the passage of time is cruel and we get old, our bodies deteriorate. More disorder. Yep… things get worse. Well, that’s the second law of thermodynamics in a nutshell.

More formally: Spontaneous processes go from relative order to relative disorder. The scientific term for disorder is entropy and so an equivalent statement is: that all processes involve increasing entropy. I like the concept that energy and matter are dissipating when disorder is increasing (I’ve borrowed from Peter Atkins, here). When the glass breaks, the glass itself spreads out into tiny pieces (its mass dissipates) and there is often quite a loud crack. The loud crack is energy dissipating in the form of sound.

But have I caught myself in an apparent contradiction? I look around my garden and it seems that the natural world is full of beautiful and complicated structures which are ordered. The fronds of a ponga fern are extraordinary spirals, the symmetry in starfish, the wonderful complexities of our own bodies – our brains are so complicated, we do not understand how they work! Life appears to be fantastically ordered. Even an E. coli cell has molecular machinery which perform incredible functions. Where did all this “order” come from, if one of the fundamental laws of the universe says that natural processes are driven towards increasing disorder? (Don’t worry, I’m not going to cite a benevolent, omnipotent designer at this point). This conundrum requires a simpler explanation, which reconciles the second law of thermodynamics with the order in the machinery of life.

If life’s machine were an engine, then it needs fuel to make it run. And the fuel is a source of energy. The process of burning this fuel (in our cars, say) dissipates lots of mass and lots of energy. Think of a tank of petrol turning into carbon dioxide, carbon monoxide, lots of heat, lots of noise. Provided that the sum total of this “dissipation of mass and energy” is greater than the “order” created by the work that the engine does, then you’re OK as far as the second law of thermodynamics goes. Incidentally, this is why we can’t get an engine which is 100% efficient, because the second law says that we must “dissipate” some of the mass and energy and not turn it entirely into productive work.

So it is the same with life. To construct life’s machinery, we need energy. We get this from food, plants get this from nutrients in the soil and sunlight. And in using all this energy, some must be dissipated, spread out, ultimately lost so that we don’t offend the 2nd law. For life, where does this energy ultimately come from? We need to work our way down the food chain to find out. Our food (and energy) comes from plants and animals. Plants get their energy from nutrients and sunlight. Animals eat other animals and plants. Plants get their energy from… sunlight. So sunlight is very, very important for life. It one of the fundatmental sources of energy  which allows the construction of ordered things like organisms. There is another, hidden source of energy on earth and this is in the earth itself. Many bacteria live by using the energy stored in minerals in the earth’s crust. These bugs are called chemolithoautotrophs! “Chemo-” because they get their energy from chemicals in the environment. “-Litho-” because these chemicals are inorganic, usually from the earth’s crust. And “-auto-” because they get their carbon from carbon dioxide.

The inorganic chemicals which these bugs use as a source of energy are the product of chemical reactions in the earth’s crust. These reactions are ultimately driven by the very hot core of our planet. And the core is hot because of gravity! The mass of the earth and its gravitational energy heats the earth’s core and drives chemical reactions in the crust. This chemistry is dramatically visible when volcanoes erupt or mud boils. In a similar way,  the sun’s energy is driven by fusion reactions which take place due to the vast pressures inside its core. This is also due to huge gravitational forces inside the sun.

So to overcome the 2nd law of thermodynamics and create life, we need a source of energy. This energy comes from the sun and the chemistry of the earth. Both energy sources are ultimately the product of gravity. Gravity gave us life. Everything else is either cooling down (dissipating energy into the surroundings) or falling apart (dissipating mass).

Some post-notes on entropy:

1. To be confused about entropy is quite all right. Here’s what the great James Lovelock (author of Gaia) said:

“Few physical concepts have caused as much confusion and misunderstanding as has that of entropy.”

or this from the mathematician John von Neumann:

“You should call it entropy, because nobody knows what entropy really is, so in a debate you will always have the advantage.”

For a combative, controversial and compelling argument for the power of the second law of thermodynamics and its central place in our understanding, watch this lecture by Oxford chemist Peter Atkins. My favourite quote from this lecture is:

“No other law of science has contributed more to the human spirit”

http://video.google.com/videoplay?docid=5497989647634565004
Print This Post Print This Post

The numbers game Vic Arcus Feb 16

4 Comments

Biology is about big and small. Really big (a whale) and really, really small (a bacterial cell). For a beautiful visual tour of the big to the very small, I can recommend this from the Learn Genetics website (this website was recently awarded the Science prize for online resources in education). This animated web page lets you zoom from a coffee bean down to a virus and a protein. To get with the jargon its an “order-of-magnitude” thing. Like all jargon, this is a fancy way of saying something simple. Two numbers differ by an order of magnitude if one is ten times bigger or smaller than the other – its just the number of zeros before or after the “1″. For example, 1 meter is 2 orders of magnitude larger than 1 cm (1 m = 100 cm). A blue whale is about 30 m long. A bacterial cell has a diameter of about 1 micrometer! All in all, life on our planet covers 7 orders of magnitude – a blue whale is 7 orders of magnitude bigger than a bacterium (30 m = 30,000,000 micrometers)!

For big and small biological numbers, many orders of magnitude apart (and for the geeks amongst us), there are a plethora of interesting and wacky examples at B1ONUMBERS. There are icky numbers – there are 10 times as many bacterial cells in your body compared to your own cells. There are practical numbers – ordinary “white collar” work requires about 8,000,000 Joules of energy per day (about 1,910,000 calories). There are environmental numbers – the average turnover of plant organic matter on land is 19 years. There are amazing numbers: An E. coli bacterium must consume 2,000,000,000 molecules of glucose before it can divide in two! For the skeptics, B1ONUMBERS provides you with the original reference and you can find out exactly how the scientists arrived at that particular value. And for the rigorous, the authors at B1ONUMBERS have written great paper on “A feeling for numbers in biology“.

In an earlier post, I talked about the ribosome which is the molecular machine that translates the information on DNA and RNA to manufacture proteins in our bodies. How fast can it do this? B1ONUMBERS says… ~16 amino acids per second! How often does the ribosome make a mistake? About once every 5 thousand amino acids!

Print This Post Print This Post

Bug of the week Vic Arcus Feb 08

No Comments

I love microbiology. Microbes are simpler than plants or animals – just single cells dividing and expanding in number (exponentially!). Microbes invented photosynthesis, they invented antibiotics, they even invented sex. Simple, yet stunningly diverse, they live everywhere – in the soil, in the rocks, in the sea, on your skin, in your stomach. There’s a whole community of bugs living in your stomach and it is said that every individual human on the planet has a different population of microbes in the their digestive tract and could be uniquely identified by them. So I thought that I would start a series on cool bugs and where they live.

This weeks bug is called Chlorobium phaeobacteroides BS1 (microbes are given two latin-style names. The first, capitalised, signifies the genus and the second signifies the species. Often there is a “strain” number after the latin names). I’ll call this bug C. pha for short. This is bug of the week because of where it lives and what it can do. It lives deep in the Black Sea, down at about 100m. There’s not much going on down there and what’s more there is virtually no light. But C. pha uses photosynthesis to generate energy, so it absolutely needs light to survive. It’s survival depends on it being one of the most efficient photosynthesisers on the planet! Down at 100m in the Black sea there is about one million times less light than at the surface. This means that there are tiny, tiny flashes of light only intermittently. To describe it another way, if C. pha were a tree in a pitch black enclosure, it could survive off the light from a small candle 50 m away! To live down deep in the Black Sea, C. pha has doubled the size of it’s light harvesting machinery, made its conversion of light to energy extraordinarily efficient, and fine tuned all of its metabolism to survive on these tiny pings of light. It uses stealth and splits in two about once a year. That compares to E. coli living in your stomach, which divides every 20 minutes.

In an age when converting light into energy (for a genuinely renewable energy source) may be one of the most important processes that we can understand, it is good to meet one of the most efficient proponents of this process – Chlorobium phaeobacteroides BS1.

Print This Post Print This Post

The ribo what? Vic Arcus Nov 17

No Comments

In the cellular city, there is one factory which reigns supreme and it is called the ribosome. This is the molecular factory which produces proteins. It is a monolithic molecular complex which literally “translates” the information in genes (encoded by sequences of DNA and RNA) into proteins. It is also very ancient and is found in all forms of life on the planet including all bacteria, plants and animals (and us). The “translation” is very complicated because is really more than translation. For example, if I were to translate some instructions from one language to another (say Danish to English) I’m not really changing the instructions – I’m simply representing them in a different language. But if I were to translate the instructions to build a house from Danish to English and then follow this by building the house, then I have transformed the instructions into something which is much, much more than words on a page. This is what the ribosome does. It takes the instructions written in the DNA and RNA and builds proteins which are the workhorses of the cell doing everything from digesting our food to combating invading bacteria. Here’s a cartoon of the ribosome in action:

YouTube Preview Image

Before 2000, what we knew about the ribosome structure was not a great deal more than the blob in this cartoon. Can you imagine going to the middle of a great city to look at its most important factory and just seeing the bland exterior walls? You might see components being delivered at one end and the finished products being taken away at the other end, but you have very little idea about how the factory works. And you’re a scientist, so knowing how things work is kinda important. In 2000, several scientific groups radically changed this view and took us from the outside looking at the walls, to the inside of the ribosome, where we could see every atom and all the machinery (including every nut, bolt and screw) which makes proteins in all cells.

For this work, three people won the Nobel Prize in Chemistry this year. As an aside, there was some surprise that a dramatic leap in biology should be awarded a prize in Chemistry. To which one of the laureates replied… “…when you look at any biological question it becomes a chemical problem…”.

The structure of the ribosome is also a great story and I was reminded about this by the public release of several original papers published by one of the Nobel Laureates, Ada Yonath. These papers were published in the Journal of Molecular Biology in the 1980s and early 1990s and have been made open access. These papers are sufficiently old that they are only available as large pdf files, but if you want to download them here is the address. The first paper (from 1984) shows some tiny crystals and pictures of “X-ray diffraction patterns” for a large chunk of the ribosome. This paper is reminiscent of the X-ray diffraction patterns recorded by Maurice Wilkins (a New Zealander) and Rosalind Franklin in the early 1950s which led Watson and Crick to propose the double helical structure of DNA.

In coaxing large pieces of the ribosome to crystallise, Ada Yonath was attempting something outrageous. In the 1980s, if you were able to crystallise a single small protein and determine its 3-dimensional structure using X-ray diffraction, you could publish the structure in the most prestigious journals. But here was Ada Yonath and her colleagues attempting to crystallise an enormous molecular complex made up of 31 proteins bound to a large RNA scaffold. Yonath and her group were not the first to finally determine the structure of the ribosome, 15 years later (just as Wilkins and Franklin were not the first to determine the structure of DNA), but it was Yonath’s tenacious and audacious work in purifying and crystallising ribosomes from weird bacteria which paved the way for others to show us the nuts and bolts of proteins synthesis. A new view which is fantastic in its complexity and which is common to all of life on earth.

Print This Post Print This Post

Helices turn right or left Vic Arcus Oct 29

No Comments

I was in the garden this weekend and I saw the new tendrils on our passion-fruit vine winding their way outwards from the main stem of the vine. The tiny passion-fruit leaders form helices which grasp onto, and wind their way around the wire which we attached to the wall. The new spring growth in the garden has lots of examples of these beautiful helical forms. There are the new spirals of the black mamaku pongas and the beans spiral their way up the netting. There is a fascinating property of helices which is worth describing. If you look at an old fashioned cork screw (which is a helix) you’ll notice that it goes in one direction. I checked our cork screw and found that it was right handed. That is, you must screw it clockwise to get it to go into the cork (in the time before screw top wine bottles). If you turn it anticlockwise, nothing happens. If the cork screw wire was straight, it wouldn’t have this “handedness” about it. But as soon as you wind it into a helix, it must be either right handed or left handed (I wonder if anyone makes left handed cork screws which go anticlockwise into the cork?). The term for “handedness” in biology is called chirality. And chirality abounds in nature. Our amino acids have chirality, our DNA has chirality. Indeed, we have left and right hands! So our bodies are chiral.

But back to the garden. I checked the tendrils on the passion-fruit vine and found that those which branch off one side of the main stem are mostly left-handed helices and those which branch off the other side of the stem are mostly right-handed. On the other hand, the beans seem to climb up the wire in spirals or helices of just one direction.

This reminded me of a wonderful picture that appeared on the front cover of the September 2009 issue of the EMBO Journal (the Journal of the European Molecular Biology Organization). This is a picture of a bacterium called Bacillus mycoides which grows in spiral shaped colonies and can be isolated from many soils. The cells themselves are slightly curved and link head to tail to form these filamentous helices. In all cases of Bacillus mycoides, the filaments grow in the same direction. But there are different strains which grow either exclusively right handed or exclusively lefthanded. The strains are like the cork screw – strain A of Bacillus mycoides always grows clockwise and strain B always grows anticlockwise (for more cool pictures down a microscope see here). This means that it is genetics which determine the way the bacteria spiral. However, scientists have yet to track down which genes are responsible for chiral growth in Bacillus mycoides. If you were an aspiring microbiologist, this would be a problem which would potentially have an impact on many, many forms of life – from bacteria to plants to people!


Print This Post Print This Post

Cooperation as a cornerstone of evolution Vic Arcus Oct 16

3 Comments

In their book, The Major Transitions in Evolution, John Maynard Smith and Eors Szathmary describe 8 great evolutionary leaps which take us from individual molecules in a primordial soup, to human societies. John Maynard Smith gave an inspirational lecture at The Royal Institute on the Origins of Life shortly before his death, which you can see here. The 8 evolutionary transitions each involve “things” coming together in a cooperative way. This is not cooperation as we would intuitively think about it – groups of people getting together to achieve a certain goals (modern government is a good example in this case). The nature of the cooperation in evolution is more fundamental. As an example, the evolutionary leap to get from genes to chromosomes involves genes becoming spliced together so that groups of genes behave as a unit with coordinated expression. A second example is the evolution of eukaryotes (we humans are made of eukaryotic cells) where, it is thought, two bacteria became fused and started acting symbiotically.

So the 8 great evolutionary transitions each represent a coming together of individual “things” which then behave cooperatively: From individual genes to coordinated collections of genes (chromosomes); From DNA chromosomes coordinating with ribosomal machinery to produce proteins and enzymes; Prokaryotes fusing to become eukaryotes; From asexual reproduction to sexual reproduction (first invented by single celled organisms); Single celled organisms cooperating giving rise to multicellular organisms; Individual multicellular organisms working together to behave as colonies (ants are a good example of this); And finally, the rise of societies where groups act together for the common good. Now, where-ever you look in nature, you will find cooperation – a biofilm of different species of bacteria, a colony of ants, a hive of bees, schools of fish, a pride of lions, a small village, a large city.

This is perhaps contradictory to our conception of evolution as survival of the fittest where we might assume that each individual organism behaves in a selfish way to maximise the transmission of their genes to the next generation. An excellent essay by Elizabeth Pennisi, appeared in a recent issue of the magazine Science (with a group of ants on the cover), where she puts the vexing question of evolution and cooperation thus… “If natural selection among individuals favors the survival of the fittest, why would one individual help another at a cost to itself?… So pervasive is cooperation that Martin Nowak of Harvard University ranks it as the third pillar of evolution, alongside of mutation and natural selection”.

One could argue that cooperation is implicit in any evolutionary step which involves a more complex organism arising from simpler ancestors. Cooperation and complexity go hand in hand. Maynard Smith, Robert Alexrod and William Hamilton (amongst many others) developed “game theory” to try to explain the connections between evolution and cooperation. They asked the question… Given a collection of individuals, be they bacteria or people, will those that cooperate, out-compete those that behave purely selfishly? And they discovered that under many circumstances cooperation wins out over purely self-serving behaviour. This is certainly evident in the natural world where cooperation abounds.

Thus, evolution and cooperation are inextricably linked and cooperation amongst individuals, be they genes, bacteria, ants or people, is a cornerstone of evolutionary processes.

Print This Post Print This Post

Extraordinary exposition – Obama’s case for science Vic Arcus Oct 07

No Comments

Obama’s speech at the National Academy of Sciences in April 2009 in which he states that “Science is more essential for our prosperity, our security, our health, our environment, and our quality of life than it has ever been before.” A transcript can be found here.

Print This Post Print This Post

The cellular phone book Vic Arcus Sep 30

No Comments

The phone book for a city is a dull read. The surnames, initials and addresses for everyone who lives in a city. For the truly bored, you might find some prurient entertainment in some of the more descriptive surnames. It’s not even complete, given that a significant number of the inhabitants choose not to have their names published. However, with a bit of analysis, a phone book turns out to be quite interesting. If you were a demographer or a town planner, you could analyse the data in a phone book and combine it with a map and make some inferences about population density. You might even plot the growth of various suburbs by tracking this data over time – compare 1990’s phone book with that of today. If you collate first names with time and watch them change, it is even possible to write a chapter in a freakishly successful book! So there are hidden gems in a collection of names for those who choose to spend their time mining such information.

So it is with the genome of an organism which is even more boring than a phone book at first glance. Here is a section of a genome from a small bacterium which lives in hot salty pools on Italian beaches – I know, its a difficult life being Pyrobaculum aerophilum which is the name of this organism:

ATGCCCGTTGAGTACCTAGTGGACGCCTCCGCGCTATACGCCCTCGCGGCCCATTACGAC
AAGTGGATCAAACATAGGGAGAAACTGGCCATTCTGCACTTGACCATATACGAGGCAGGC
AACGCGTTGTGGAAAGAGGCGAGGCTCGGGAGAGTGGACTGGGCCGCCGCGTCTCGGCAT
TTGAAAAAGGTGTTGTCCAGCTTCAAGGTGTTGGAGGACCCGCCCCTAGACGAGGTCTTG
AGGGTGGCCGTGGAGCGGGGCTTGACCTTCTACGACGCCAGCTACGCCTACGTGGCGGAG
TCCTCCGGACTAGTCTTGGTGACGCAAGACCGCGAGCTACTGGCCAAGACGAAAGGCGCT
ATAGACGTCGAAACTTTACTGGTAAGGCTGGCGGCACAATAA

These are 402 letters of the bacterial genome which has a total 2,222,430 letters carrying all of the genetic information for Pyrobaculum. Adding to the boredom and drudgery is the fact that the biological alphabet has just four letters – A, T, G and C which denote the four “nucleotides” or molecules which are linked together head-to-tail to make up the genome. Thus, the genome is just one long string of letters, in the case of Pyrobaculum, 2,222,430 letters to be precise. But just as the phone book for a city has hidden treasures for genealogists and demographers, so too the genome gives up its secrets for those inclined to spend their time analysing this code. If we split the sequence above into groups of three, the first line reads like this:

ATG CCC GTT GAG TAC CTA GTG GAC GCC TCC GCG CTA TAC GCC CTC GCG GCC CAT TAC GAC

And then we can use a table to translate the code into amino acids (each group of three nucleotides codes for one amino acid):

M P V E Y L V D A S A L Y A L A A H Y D

These amino acids are then linked together to form a protein (402 nucleotides translates into 134 amino acids)  which has a beautiful structure…

a protein structure

Thus, from the ostensibly boring collection of 402 letters (above) and given some anlaysis (genetics plus biochemistry) we have arrived at the structure of a protein which is encoded by these letters. This structure tells us about the function which this protein performs in the cell and the function of a protein is the work it does to keep the cell alive (in the hot salty waters at the beach).  A bit like the yellow pages of the city phone book which gives the work addresses for people in the city.

Via this decoding process we can take the Pyrobaculum aerophilum genome of 2,222,430 letters and divide this into 2,706 genes which encode 2,605 proteins and viola! We have the Pyrobaculum phone book. I guess that we should say that Pyrobaculum is really a village in this context as it only has 2,605 inhabitants.

In the last post, I talked about the phenomenal complexity of the cell, but this all seems quite straightforward – take the genome, split it up into its various genes and decode the genes into proteins. Each protein has a specific function and collectively, the 2,605 proteins work together to keep the cell alive. Just as the inhabitants of a village work on specific tasks and the sum of this work makes the village thrive. However, if your aim were to describe the city or village, its rich history, its buildings, its evolution, it people and the principles by which it thrives (see the last post), could you achieve this armed with just a phone book? Obviously not. The phone book gives up some secrets but is just a very small component of the picture which constitutes a complete description of the village or city.

Modern genomic technology has been extraordinarily successful and to date, we have the complete genomes (phone books) for more than 1000 organisms including bacteria, fungi, plants and mammals. But the phone book is just the beginning, and to describe a cell, we need much more than just a list of its protein inhabitants.  Ekistics is the science of human settlement which spans the beautiful and complex history, evolution, physical description, social interaction and heirarchical organisation of villages and cities. Molecular biology is the ekistics of the cell. By all means start with the phone book and see what you can glean from it, but then take up history, cartography, evolution and economics and see where that leads you.

Print This Post Print This Post

The city and the cell Vic Arcus Sep 29

1 Comment

A city from space resembles a dense mosaic. Roads prescribing the polygons and curves of the myriad city blocks and parks. The city periphery is often constrained by geography: mountains to the east, a river runs through it, the sea to the west. The city plans are, in some cases, the result of the invisible hands of the town planner (for a modern city such as Canberra) which rationally demarcate residential, industrial and commercial zones. These “plans” are no less apparent for a medieval city whose organization has a vernacular and sometimes brutal history as its architect. Carcasonne is one such beautiful medieval city surrounded by walls, two thick, replete with battlements, ramparts and parapets. These defenses are a relic of more strident times when small feudal states were frequently under attack. The environment surrounding the city is of equal importantance, providing the farmland, crops and resources – the energy – to keep the city (and its inhabitants) alive.

What would constitute the science of a city? Ekistics is the science of human settlements – a discipline pioneered by C.A. Doxiadis, a 20th century Greek academic who died in 1975 – which sought to systematically study our villages, towns and cities. For our purposes, as city scientists, we might start with a map! And a detailed description, which seems straightforward, but belies a fantastic complexity, even for a small city of 50,000 such as Carcasonne. The cartographers who produced early maps with their illuminations were as much artists as scientists. Nevertheless, the bare, physical structure of the city is enunciated. So we start with a map. What of the inhabitants, the production, the webs of commerce and social interactions? To account for the inhabitants one might obtain a phone book and be satisfied that now we know the names of all the people and their addresses overlaid on the map. A further level of complexity would be gleaned from the yellow pages which gives the addresses of all the workplaces in the city and, with a little investigation, the inhabitants who occupy these workplaces. We could even arm ourselves with photographs of the buildings to view their adornments, colours, size and geometry. The organizational and political structure of the city also seems important – its governors, its bylaws, its hierarchy, and accounting for the movements of people in and out of the city along with the movement of goods and energy, brings us close to a contemporary picture. But still we are descriptive observers accounting for a static view of the city.

To qualify as scientists, our account needs to be explanatory. Are there general principles which explain how the city came to be like it is? An account of the history, in the case of Carcassone, its sackings and capitulations, it feudal lords, its families, its peasants and farmers is vital. Further, would these principles have a predictive component? If we knew the history and the principles of the evolution of the city, can we predict the future of the city? Doxiadis would say yes, but it is phenomenally complicated. Who would have thought that there was such art, illumination and science in town planning?

For the parallels between the city and the cell, Dr Suess can lead us there: “Horton Hears a Who” is dedicated to Mitsugi Nakamura from the concurrently historic and thoroughly modern city of Kyoto. Although some may argue that this children’s fable is about the benefits to Japan of the benevolent U.S. post-war occupation its really about the city and the cell! In it we find Horton…

On the fifteenth of May, in the Jungle of Nool
In the heat of the day, in the cool of the pool
He was splashing… enjoying the jungle’s great joys…
When Horton the elephant heard a small noise.
…
“I say!” murmured Horton. “I’ve never heard tell
Of a small speck of dust that is able to yell.
So you know what I think?… Why, I think that there must
Be someone on top of that small speck of dust!”

Horton goes on to discover not just a person on the speck of dust, but a whole city of Whos (whom Horton must protect). A description of this tiny city, not visible, but certainly real for Horton, is the same as that for Carcassonne, with its phenomenal complexity of people and the physical environment overlaid with history. And this is the colossal task which faces scientists in describing and understanding a cell. A cell has inhabitants (proteins, RNA, DNA and small molecules) and very well organized defenses which are often two or three deep (in the form of cell walls). These defensive lines are policed by gatekeepers who restrict the traffic in and out of the cell. Internally, the cell has a heavily regulated organizational structure with governors, activators and repressors! There is a phone-book (both white and yellow pages) in the form of the genome which is a list of all the proteins and RNA in the cell and encodes where they live and work. And there is an evolutionary history to the cell which explains why it is how it is, and provides some predictions about how it might look in the future. Indeed, over time there will be invaders (viruses), wars, alliances and treaties, which all leave historical traces for scientists to find.

So to describe a city with all its buildings, its people, the colours, congregations, communities and industries, and to overlay this with principles which chart its history and its future, is a similar task to studying a single cell. Were to start? I think that the phone book is a good place, and that will be the subject of the next post.

Print This Post Print This Post