Posts Tagged evolution

Lawrence Krauss on a bad day David Winter Mar 17

1 Comment

Dunedin got to see Lawrence Krauss on a good day and a bad day this week, but that’s not to say one of his presentations was better than the other. Yesterday the award winning physicist and scientific communicator revealed to his audience that his outlook on life changes from day to day. On good days he can revel in the wonder of a universe that could come to know itself due to a series of accidents that started 10-31 seconds after the big bang and allowed the creation of first matter then atoms, stars and planets and finally astronomers. On bad days he despairs at the lack of scientific thinking in journalism and politics and thinks these problems, and the anti-scientific forces that fuel them, will probably prevent us from doing anything meaningful about climate change.

Krauss’ awe inspiring story of an atom’s journey from the birth of the universe to its death will gain nothing from my retelling it. If you weren’t able to see it then you’l be glad to know his talk was a précis of his excellent book ATOM: An Odyssey from the Big Bang to Life on Earth…and Beyond and covers similar ground to this recored lecture. Perhaps I’m a masochist and a pessimist, but I’m going to skip the awe inspiring story to focus on what Lawrence Krauss thinks about on a bad day. His talk on “Science, Non-Science and Nonsense” described the sources of scientific confusion in society and the tactics used by those groups that seek to take advantage of it.

Krauss argued that the goal of science education and science communication should be to make sure everyone develops a functioning bullshit filter. He didn’t express his thesis quite as bluntly as that, but his core idea is that spreading a scientific mindset would allow us to short circuit needless debates (is global warming real?) and let us get on to the important ones (what are we going to do about it?). He used a neat example to illustrate how this sort of scientific common sense could stop nutty ideas before they get started. UFO enthusiasts often cite the ability of the lights they observe to perform right angle turns at speed as evidence of their otherworldliness. In fact, Krauss pointed out, common sense should tell us that these apparently amazing maneuvers are evidence that the lights in question are not being emitted by a massive object moving through the sky. The only way to turn at a right angle is to stop then change direction, for a UFO to do all its slowing down and stopping so quickly a human observer couldn’t perceive it would generate G-forces with a strength about 2000 times greater than earth’s gravity. And quite a mess.

If the evidence used by UFO junkies is so silly then why do continue prosper? Why aren’t people already filtering this sort of nonsense? The standard of scientific reporting in the media certainly has a lot to answer for. Krauss cited the normal concerns, a fractionated media market means viewers can choose a source of news that confirms their biases and the innate need of journalists to present balance is misplaced in science stories when, in almost every case, one side is wrong and we usually know which side that is. He also mentioned something I hadn’t thought about before. According to Krauss, part of the problem with science coverage in mainstream reporting is that journalists don’t feel qualified to make scientific pronouncements. Writers and broadcasters are happy to make bold statements on politics, financial markets and sports but will shy away from even a scientifically uncontroversial statement like “evolution is a fact.”

Scientific understanding might not be helped by meek journalists and the false equality of balance but most journalists aren’t setting out to deliberately mislead the public on science. Unfortunately, there are forces at work that are doing just that. Krauss had a tonne of examples from the culture wars in his native USA to draw on but he also took the time reminded us of our home grown cranks, citing the New Zealand Climate “Science” Coalition and Ray Comfort (The Apologist’s Nightmare ) as evidence we aren’t immune to anti-science in New Zealand. As you’d expect Krauss exposed just how vacuous the claims of intelligent design creationism and the objections of climate change denialists are, but he also attempted to deconstruct the PR strategies each group use. Both campaigns seek to take advantage of the public’s sense of fairness and journalists’ willingness to provide balance to any point of view. The Discovery Institute would have you believe their goal is simply to get their science a fair hearing in the classroom. But they don’t have a science. For normal science, theories only make it into the school curriculum after they’ve been proposed, tested, retested and confirmed. The ID crowd don’t want fair treatment, they want special treatment, to avoid that boring scientific process and start in the classroom!

Krauss could hardly have known this, but our own climate cranks play the same game. I hate to make an example of this article because the author usually covers science well, nevertheless it highlights the point. In an effort to provide balance to a story on how the IPCC might be made better the author contacted Vincent Gray for comment, here’s the paragraph

Wellington scientist and climate change sceptic Vincent Gray said the researchers were continually coming up with “new models” but they were still “fiddling the figures” and were unlikely to restore public confidence in their work until their projections were proven

That sounds pretty fair doesn’t it? Climate scientists can run their model forward in time and if their projections match observations we’ll take action. Actually, it’s absurd. As Krauss emphasised in his talk, the evidence for climate change doesn’t only come from models, we have tonnes of data that tell us the earth is warming and the seas are rising. Combine those data with the fact recent temperature records are within the uncertainties of the IPCC’s projections and sea levels are near to the upper bound of those projections and Gray’s sound bite seem less fair.

Krauss had more problems than solutions in his hour long presentation. In fact, it’s a testament to the passion he has for his science and skill he has as a scientific communicator that he managed make a talk made almost entirely of depressing facts seem invigorating. The only ray of hope Krauss offered us was that when people’s backs are to the wall they abandon their their preconceptions and to turn to science. In 2003 George W. Bush said that he believed “both sides” of the “evolution debate” should be taught in schools. In 2005 Bush was faced with the prospect of Avian flu becoming able infect humans. Confronted with threat of a flu pandemic the Bush administration dispensed with its evolutionary agnosticism and planned for the possibility of genetic mutations allowing viruses to pass from human to human. That sort of infectivity requires conformational changes in surface proteins which create a new function, exactly the sort of phenomenon the ID crowd think is so improbable as to be effectively impossible.

Krauss will be presenting something very similar to his Dunedin talk in Auckland next week. I’d encourage anyone who has the chance to get out and seem him, he’s a very chrasmatic and interesting speaker. You might even ask the question I really wish I did now- how are we going to fix all these problems?

Nucleotide diversity – what two new African genomes mean David Winter Feb 26

No Comments

ResearchBlogging.org

If you wanted evidence that we live in a post-genomic age you would need to look no further than the headlines in the science section of the newspaper last week. A man dubbed Inuk who lived and died in Greenland 4 000 years ago had dry earwax and might have gone bald if he lived long enough, Tutankhamun was inbred and had a cleft palate and Desmond Tutu has had his whole genome sequenced. What about the science behind the hook? Ed Yong has the the story of Inuk (whose genes tell us about migrations into and out of North America). I’ll leave it the reader to imagine what the broader significance of Titankhamun’s illnesses might be but the publication by Stephan Schuster and colleagues of complete genomes from Desmond Tutu and !Gubi, a Khoisan tribal elder, is an important step in our understanding of human genomic diversity.

As I’ve said before there really is no such thing as the human genome. There are millions of differences between individual genomes and we are each born with about 150 new muations. In an age in which we can sequence assemble and analyse entire genomes in two years understanding the breadth of human genetic diversity is at last an achievable goal and if you want to understand human diversity then you need to look to where we came from. Trace any family tree back far enough and you will end up in Africa and, in fact, most of human history was played out entirely in that continent. Modern humans arose in Africa about 250 000 years ago and only spread out to Europe and the rest of the world in the last 60 000 years, displacing Homo erectus in the process. The migrants that founded the modern European, Asian and American populations would have carried with them only fraction of humanity’s genetic diversity when they left Africa but untill recently genomics has focused on those populations. Until last week the two African genome sequences available to researchers were both from Yoruban volunteers to the hapmap project. Although those sequences are very useful they represent only one tip in the deeply branching tree of humanity

Summary of human genetic diversity redrawn from Campbell and Tishkoff (2008) doi:10.1146/annurev.genom.9.081307.164258 . Numbers in brackets are the number of complete genome sequences from each region available before last week.

To broaden our understanding of African genomes Schuster et al looked to the South of the continent and at two people in particular. !Gubi is a Khoisan (or bushman), a member of a one of the earliest diverging groups within the humanity while Desmond Tutu hails for various Bantu peoples. The results taken from theses genomes along with lower density sequencing and genotyping of other Bantu and Khoisan volunteers reinforces just how much genetic diversity exists within Afirca. By using a method called principle component analysis to reduce a the correlations among millions of single base pair differences (single nucleotide polymorphisms or SNPs) to a smaller set of uncorrelated vectors you can see patterns in the genetic diversity of groups. Applying this method to West African (Bantu and Yoruba), Khoisan and European populations reveals the comparative genetic homogeneity within Europeans and that the difference between the two African groups is comparable to that between either of them an Europeans.

All in all Schuster et al found 1.3 million SNPs that hadn’t been previously identified. Those new polymorphisms will be a boon to researchers searching for a genetic basis to, for instance, HIV restiance in Africa or African-American’s increased risk to type 2 diabetes. Just as interesting as the new SNPs is the discovery of others that have already been associated with diseases even though Desmond Tutu and !Gubi are healthy 80 year olds. A couple of scientists quoted in dispatches seem to think these genomes will act as quality control, allowing researchers to ‘clean up’ polymorphisms incorrectly associated with dieseases in other studies but it seems at least as likely that something more complex is going on. The selective, or health, value of a gene can only be measured against the environment it is expressed in and the rest of the genome is absolutely part of that environment. It’s entirely possible for a gene to be associated with Wolman disease amongst Europeans but to be of no consequence to busman thanks to the different genetic background against which it expressed.

Uncovering the genetic basis of these diseases and untangling the complex genetic interactions that underly populations’ risk to disease still lies in the future but this study also tells us something about our past. Most Khoisan are nomadic hunter-gathers and their ancestors have been for thousands of years, by comparing their sequences to those from agricultural societies you can see the evolutionary impacts of that change in lifestyle. Some malaria resistance genes, scars from humanities long battle with that disease that was amplified when agriculture lead to increased population density, are absent from the Khoisan sequences as are genes for digesting lactose as adults. Though those primitive characters have been retained by the Khoisan they are no more an ‘ancient’ or primitive people than the tuatara is a ‘living fossil’. In fact, there are a large number of bases in which European sequences are identical to the corresponding chimpanzee sequence while the Khoisan sequences diverge – lots of those changes will have been fixed at random but the fact some of them are in genes that are likely target of selection (especially perception of taste and smells and immune responses) suggests they may also have adaptive consequences.

The paper is available to under a creative commons license here and if you feel suitably qualified you can play with their data which has been released on the Galaxy framework.

Schuster SC, Miller W, Ratan A, Tomsho LP, Giardine B, Kasson LR, Harris RS, Petersen DC, Zhao F, Qi J, Alkan C, Kidd JM, Sun Y, Drautz DI, Bouffard P, Muzny DM, Reid JG, Nazareth LV, Wang Q, Burhans R, Riemer C, Wittekindt NE, Moorjani P, Tindall EA, Danko CG, Teo WS, Buboltz AM, Zhang Z, Ma Q, Oosthuysen A, Steenkamp AW, Oostuisen H, Venter P, Gajewski J, Zhang Y, Pugh BF, Makova KD, Nekrutenko A, Mardis ER, Patterson N, Pringle TH, Chiaromonte F, Mullikin JC, Eichler EE, Hardison RC, Gibbs RA, Harkins TT, & Hayes VM (2010). Complete Khoisan and Bantu genomes from southern Africa. Nature, 463 (7283), 943-7 PMID: 20164927

Charles Darwin and the Origin of Spouses David Winter Feb 12

2 Comments

Happy Darwin Day everyone! Today would have been Charles Darwin’s 201st birthday so around the world geeks are celebrating, churches are standing up to creationism and at least a few biologists are trying to eat their way through the tree of life. With Darwin Day falling so close to Valentines Day I thought it might be fun to forget about Darwin’s science just for a few minutes and look at his attitude to love and marriage.

No one has ever accused Darwin about making a rush to judgement about any topic. Just as he spent years poring over the minutest detail of barnacle anatomy before he published The Origin he gave the topic of marriage careful consideration before singing on. In fact, preserved in his notebooks we have a record of the deliberations he undertook. Sometime in 1838 Darwin turned to a new page in his notes and drew a line down the middle, he added the headings “Marry” and “Not Marry” to either side of the line an proceeded to list the pros and cons of either decision. You can see the notebook here but below (presented without comment) is a transcript :

Marry

  • Children — (if it Please God)
  • Constant companion, (& friend in old age) who will feel interested in one
  • Object to be beloved & played with —better than a dog anyhow.
  • Home, & someone to take care of house
  • Charms of music & female chit-chat.
  • These things good for one’s health.
  • Forced to visit & receive relations but terrible loss of time.

Not Marry

  • No children, (no second life), no one to care for one in old age.
  • What is the use of working ‘in’ without sympathy from near & dear friends—who are near & dear friends to the old, except relatives
  • Freedom to go where one liked — choice of Society & little of it.
  • Conversation of clever men at clubs
  • Not forced to visit relatives, & to bend in every trifle.
  • To have the expense & anxiety of children
  • Perhaps quarelling
  • Loss of time.
  • Cannot read in the Evenings
  • Fatness & idleness
  • Anxiety & responsibility
  • Less money for books &c
  • If many children forced to gain one’s bread. (But then it is very bad for ones health to work too much)
  • Perhaps my wife wont like London; then the sentence is banishment & degradation into indolent, idle fool

On the “marry” side of the page Darwin makes his conclusion:

  • My God, it is intolerable to think of spending ones whole life, like a neuter bee, working, working, & nothing after all.
  • No, no won’t do. — Imagine living all one’s day solitarily in smoky dirty London House.
  • Only picture to yourself a nice soft wife on a sofa with good fire, & books & music perhaps — Compare this vision with the dingy reality of Grt. Marlbro’ St.
Darwin made his list a year before his engagement to his cousin Emma Wedgwood and it seems from their letters to each other and their personal diaries that Charles’ “nice soft wife” more than made up for the money he didn’t get to spend on books. There is a movie out at the moment which apparently makes much of the religious divide between the Darwins. Emma was certainly a devout Unitarian (apparently she made the children turn their heads during the Nicene Creed and their local Anglican church!) who worried that Charles’ skepticism of religion would prevent them from being joined in Heaven. Religion was a sticking point for the Darwins but they reached a sort of detente on the topic epitomised by one of Emma’s letters to Charles during their engagement:

When I am with you I think all melancholy thoughts keep out of my head but since you are gone some sad ones have forced themselves in, of fear that our opinions on the most important subject should differ widely. My reason tells me that honest & conscientious doubts cannot be a sin, but I feel it would be a painful void between us. I thank you from my heart for your openness with me & I should dread the feeling that you were concealing your opinions from the fear of giving me pain.

Did the Moa’s ancestor fly to New Zealand? David Winter Feb 04

24 Comments

ResearchBlogging.org

New Zealanders often think of our unique biota as a sort of time capsule – a glimpse at lifeforms that have long since been extinguished in other parts of the world. New Zealand has been apart from the rest of the world for 85 million years. At that time the land that makes up our mini-continent split from the super-continent Gondwana, opening up the Tasman Sea and moving northward . A land apart from the rest of the world. Until recently most scientists have thought that the subset of the Gondwanan flora and fauna that set sail on that proto-New Zealand was likewise on its own evolutionary trajectory -insulated from biological happenings in the rest of the world. The idea of the New Zealand biota as a group of refugees from an ancient ecosystem hanging onto “Moa’s Ark” has become part of the New Zealand psyche.

In recent years Moa’s Ark has sprung more than a few leaks. Icons of our Gondwanan heritage like Nothofagus beech trees have been shown to be recent arrivals. Geologists have suggested the whole continent submerged 20 million years ago, drowning any refugees still on board, and now new research suggests even the most unlikely of immigrants – the giant, flightless moa – may have arrived in New Zealand well after we left Gondwana.

The group of birds to which the moa belonged, the ratites, have long fascinated evolutionary biologists. All the ratites are flightless (though, as we’ll see they are related to the quail-like tinamous which can fly passably well) and all the major landmasses that had their start in Gondwana had at least one ratite species before humans arrived on the scene. Africa has ostriches, South America the rhea, Australians have emus and cassowary, Madagascar had the Elepahant bird and New Zealand lost the moa but retains the kiwi. The far flung distribution of the ratites and their apparent lack of ability to disperse between continents has led to them being put forward as a classic example of an idea called vicariance biogeography in which the evolutionary history of a group is driven by the geological history of the land on which they live.

For vicariance biogeographers the evolution of the ratites was driven by the movement of the continents. The ancestor of all modern ratites was a flightless bird living in Gondwana and as each new continent split and rifted away from the super continent it took with it a population of ratites which adapted to the ecological changes brought on by their continent’s journey: cassowaries in the Wet Tropics of Australia, ostriches on the African Savannah, rhea on the Pampas. It’s certainly a nice story, but science has a way of ruining nice stories. The role of vicariance of evolution in the ratites was put to the test once we became able to use molecular evidence to reconstruct the relationships between species. If the geologically driven sketch of ratite evolution I presented above is right then the pattern of branching we find among ratites from different continents should match the order in which we know the continents broke up, something like this:

In 2001 Alan Cooper and colleagues sequenced the entire mitochondrial genome (some 12 000 bases of DNA) from representatives of each of the extant ratites and, remarkably, two species of moa. The long, careful process of retrieving DNA sequences from sub-fossil bones deserves a post of its own but for the sake of this article we only need to know what Cooper et al found when they used that DNA to recover the the relationships between ratite species.

The species in bold text above don’t fit the pattern that we’d expect from geology alone. If ratite relationships simply reflected the Gondwanan breakup we’d expect to see ostriches grouping with rheas (and apart from the other ratites). New Zealand’s two ratite orders are even more surprising, the kiwi lineage is more closely related to the Australian ratites than it is to the moa species. When combined with a molecular clock analysis Cooper et al. concluded that modern kiwis are the descendants of ancient immigrants hailing from either Australia or islands in the Lord Howe Rise (which have since submerged). In order to explain that trans-tasman dispersal the authors reached for the last resort of the desperate biogeographer and invoked a land bridge for which there is little geological evidence. In fact, as we’ll see it now seems more likely that the ancestors of the kiwi and the moa flew to New Zealand.

Even with the mitochondrial phylogeny of the group published there was considerable room for uncertainty in how the ratites related to each other. The underlying shape of ratite tree makes it particularly difficult to accurately recover with phylogenetic methods. When we use DNA sequences to estimate a phylogenetic tree we need to find species that share mutations that have accrued during the evolution of the group we’re looking at. The branches that relate the different ratite species are relatively short, so there was little time for mutations that set related groups apart from more distantly related ones to accrue. Even worse, the branches that reach to the modern species (the tips of the tree) are very long meaning there has been a lot of time to any mutations that did accrue in those critical short branches to be overwritten*. There are three approaches to dealing with this problem – sequence more genes (since each unlinked gene acts as a separate witness to the evolution of the group), sequence more samples (especially if doing so breaks up a long branch) or use a better model for the way mutations accrue in the genes you are studying. People have tried all three methods to get a better look at ratite evolution. Last year a group centred around the Field Museum in Chicago published a mutli-gene phylogeny of all birds that contained a big surprise for ratite evolution- the most recent common ancestor of all ratites flew.

As long as the ratites grouped together in a phylogeny it was reasonable to assume that they all inherited their flightlessness from the common ancestor of the group. The Field Museum study found that, in fact, the flying tinomous fit right in the middle of the flightless ratites. So, either the most recent common ancestor of the ratites and the tinamous flew and ratite lineages have subsequently lost that ability at least three times or that ancestor was grounded and the tinamous have rediscovered flight. In vertebrates the evolution of true flight has happened three times (in bats, pterosaurs and birds) while there are hundreds of examples of birds that have given up on flying. Moreover, a group of flying birds that are prone to flightlessness is hardly anything new – at least 30 species of rail (including our own weka and takahe) have taken to life on the ground. Given the ways the odds are stacked towards losing flight it seems probable the common ancestor that relates tinamous and ratites flew. The Field Museum study didn’t include any moa species and didn’t attempt any molecular dating so it’s hard to see just how the ancestors of the kiwi and the moa made it to New Zealand

A new study (I knew I’d get to it eventually) published in Systematic Biology throws some light on the New Zealand ratite story. Matt Philips and a team of researchers from the Alan Wilson Centre at Massey University took another look at the mitochondrial dataset used in Cooper et al’s 2001 study by adding more kiwi species and using models of DNA evolution that avoid some of the pitfalls of the ratite phylogeny’s difficult shape. The new ratite tree and a molecular clock analysis based on that tree confirm the idea of multiple loses of flight in the ratites and add a new finding – the closest living relatives of our giant moa are the quail-like tinamous:

So what does the new understanding of ratite relationships mean for our ideas about the origins of New Zealand’s ratites? The molecular clock doesn’t quite tick with the regularity of a stopwatch, so there is a good deal more uncertainty in the timing of the events presented above than the precisely defined nodes suggest. Still, even with the uncertainty of molecular dating taken on board we can safely say that both the New Zealand ratite lineages departed from their closest relatives after the Tasman Sea opened up.

The revelation that the tinamous are the moa’s closest living relatives suggests that the moa had ancestors that could fly. So, it seems the first proto-moa to arrive in New Zealand flew, or more likely was blown, here from Antarctica. Antarctica? It still seems amazing to me but 30 million years ago Antartica was still attached to South America and, without the circumpolar current to isolate from the world, was a relatively verdant continent. We know from fossils that Antarctica supported southern beech forests (still found in Chile, New Zealand and Australia) and marsupial mammals (strangely absent in New Zealand but still present in Australia and South America) so it’s no great stretch to propose the representatives of another Gondwanan group lived there. Antarctica certainly seems like a more likely jumping off point for dispersing proto-moa than South America, but either way it certainly seems they made it here under their own power.

The mode of dispersal for the kiwi’s ancestor is a little less clear. As we’ve seen we can be quite sure that they arrived in New Zealand after the Tasman Sea opened up and there is really no good evidence that there was ever a land-bridge across that sea. We can probably rule out walking. If we disregard the problem of dispersal for a second the simplest way to explain the distribution of flightlessness on the Phillips et al phylogeny is with a single loss of flight in an ancestor shared by kiwis and the Australian ratites. Under that scenario the kiwi would, presumably, have had to raft to New Zealand. Alternatively, given that we’ve seen the ratites seem to have an inbuilt propensity to becoming flightless we might imagine that the common ancestor shared by the kiwi and the Australian ratites could fly and each lineage has since lost that ability. In this case the kiwi could simply have flown from Australia to New Zealand (a journey that storms frequently inflict on Australian birds today). Without sufficiently old ratite fossils from either country it’s hard to choose one scenario over the other.Long range dispersal by rafting is probably an important force in biogeography but if I was forced to make a bet I’d put my money on ancient flying kiwis.

The radical rethink of ratite evolution that a decade of molecular phylogenetics has forced on us raises a lot of interesting questions. What it is it about the ratite body plan, development or behaviour that makes them so prone to flightlessness? Is that repeated loss of flight, and consequent lack of pressure to keep their weight down, enough to explain the trend towards gigantism? The authors of the most recent paper suggest both trends might be explained by ratites on each continent filling the ecological niches left by the extinction of the dinosaurs. The dates on their tree are certainly consistent with the idea that each ratite lineage independently took to the ground 65 million years ago but without more fossils and more precise dates for each split it’s very hard to test the idea further. I’m sure the story of ratite evolution has more surprises for us to uncover.

*

Outrageously geeky aside: these sorts of phylogenetic trees can even fall into the terrifying Felsenstein Zone in which the confidence with which you estimate the wrong tree increases as you throw more data at it.

Links to the primary literature are provided below but you should also check out Simon Collins excellent piece in the Herald and Mike Dickison, who got his PhD studying giant flightless birds and wrote about the idea that ratites flew to New Zealand way back in 2007.

Cooper A, Lalueza-Fox C, Anderson S, Rambaut A, Austin J, & Ward R (2001). Complete mitochondrial genome sequences of two extinct moas clarify ratite evolution. Nature, 409 (6821), 704-7 PMID: 11217857

Harshman, J., Braun, E., Braun, M., Huddleston, C., Bowie, R., Chojnowski, J., Hackett, S., Han, K., Kimball, R., Marks, B., Miglia, K., Moore, W., Reddy, S., Sheldon, F., Steadman, D., Steppan, S., Witt, C., & Yuri, T. (2008). Phylogenomic evidence for multiple losses of flight in ratite birds Proceedings of the National Academy of Sciences, 105 (36), 13462-13467 DOI: 10.1073/pnas.0803242105

Phillips, M., Gibb, G., Crimp, E., & Penny, D. (2009). Tinamous and Moa Flock Together: Mitochondrial Genome Sequence Analysis Reveals Independent Losses of Flight among Ratites Systematic Biology, 59 (1), 90-107 DOI: 10.1093/sysbio/syp079

The why of the Y-Chromosome’s amazing evolutionary rate David Winter Jan 15

No Comments

ResearchBlogging.org

There is something faintly pathetic about the Y-chromosome when its lined up with its peers in a karyotype. Each of the 22 numbered chromosomes pair off with a near identical partner just their size while the Y has to shape up to the X which has more than twice as much DNA and 25 times as many functional genes.

The puny Y-chromosome only looks worse when you realise that mammalian sex chromosomes weren’t always so mismatched. 160 million years ago the X and Y were just another pair of chromosomes, albeit the pair that the carried the sex determining gene SRY. Over time the chromosome that went on to become the Y stopped swapping genes with its partner, allowing it to maintain a suite of genes that are beneficial in male bodies but not in females. It’s the lack of genetic recombination that sent the Y into its decline. Genes on any other chromosome can be swaped between pairs, meaning over many generations individual gene copies (called alleles) are exposed to natural selection independently of alleles either side of them. The same process doesn’t apply to alleles on the Y-chromosome. Since the Y is always passed on as a single unit natural selection acts on the whole thing – a broken gene might make it into the next generation because it is attached to beneficial mutations. The efficiency of natural selection is further reduced in the Y-chromosome because it has a relatively small effective population size (less that one quarter of that for normal chromosomes since only males carry the Y and then in only one copy and even then a larger number of males than females don’t contribute to the next generation) which makes genetic drift a strong force.

What we’ve known about the Y-chromosome’s past has has shaped out ideas about what it is now and what it will become. Until quite recently the Y was seen as more or less a derelict chromosome, a few broken remnants of the genes still found on the X and a couple of male-specific genes hanging on the the sex determining gene SRY. People have even go so far as to extrapolate the Y’s long slow decline to a future time at which the Y will simply disappear. The first clue that the Y-chromosome might be a little more resilient than that came in 2003. The publication of the complete sequence of the human Y-chromosome revealed more than fossils from the Y’s more substantial ancestor. There are plenty of those so called “X-degenerate” segments but most of the active genes in the Y are in large repetitive runs of DNA called the “ampliconic regions”. The genes in these regions are mainly made of DNA sequences unique to the Y chromosome and are expressed only in the testes – suggesting the Y has been making its own genes at the same time that its been losing the X-degenerate ones.

Untill this week it has been hard to test the idea of a regenerating Y-chromosome in an evolutionary framework. Those large repeated runs of DNA are very hard to sequence (the standard metaphor is putting together a jigsaw puzzle made entirely of sky) so we haven’t had another Y-chromosome sequence to compare ours with. Now, thanks to Jeniffer Hughes and colleagues, we do and the result it stunning. Not only has the Y-chromosome been making genes, it’s been making them at an outrageous rate. Thirty percent of our Y-chromosome sequences have no counterpart in the chimpanzee. As the authors say that’s the sort of divergence you’d expect to see between humans and chickens, which are separated by 310 million years of evolution not humans and chimps which only split 6 million years ago!

It’s evident that, far from being in the tail end of an inexorable decline, the Y-chromosome is evolving a good deal more quickly than the rest of the genome. So, the burning question is what is behind that evolutionary rate? There is probably no single answer to that question but it’s safe to assume it results from some of the unique features of the Y-chromosome; a lack of genetic recombination, the presence of those large repetitive sections of DNA and the preponderance of male specific genes.

It’s usually a good idea when trying to explain an evolutionary phenomenon to think of explanations that don’t invoke natural selection as the main driver as a sort of null hypothesis against which to test other ideas. In this case the increased fixation of new genes on the Y-chromosome might simply reflect an increased rate of production of new genes. Those highly repetitive sections of the Y-chromosome are the perfect substrate for a process called ectopic gene conversion in which a Y-chromosome can recombine with itself and as a result duplicate streches of DNA. We know from human studies that a process like this has made wide scale structural changes in the last 100 000 years and it might be enough to explain the Y’s unusual gene production.

I think it’s very likely that natural selection also plays a role in the number of of those new genes that become fixed in the human and especially the chimp lineage. Most of the active genes on the Y-chromosome are expressed in the testes and involved in sperm production. Chimpanzees are highly polygynous polygynandrous [Thanks to Harvest Bird for pulling me up on this,], in most cases a female will mate with each of several dominant males in a troop, and a result sperm competition is an important level of selection. Although humans aren’t as polygamous as chimps (and likely haven’t been in our recent history) it’s clear that fertility selection is still an important force and we know for sure that mutations in the Y-chromosome can lead to infertility so, again, the fate of new genes on the Y-chromosome are likely to be driven by selection.

Both the adaptive and non-adaptive explanations above might will be influenced by the lack of recombination in the Y-chromosome. The reduction in the efficiency of natural selection described above will stop very slightly deleterious mutations from being driven to extinction which might mean new genes that would be selected against on any other chromosome become fixed on the Y. This phenomenon can be enhanced when it is coupled with selection producing a ’selective sweep’. If a new beneficial mutation, perhaps associated with sperm competition or fertitily selection, pops up in on a chromosome with a bunch of other mutations that whole thing will be selected for and driven to fixation which has the potential to make for large scale changes quickly.

It is likely that the amazing evolutionary rate of the Y-chromosome is a result of some combination of all these factors but it should be possible to disentangle at least some of their contributions. If sperm competition is a major driver of Y-chromosome evolution then it follows that animals that go in for purely monogamous relationships will have comparatively low rates. Evolution has furnished us a natural experiment to test this idea, all gibbon species form pair bonds and are highly monogamous. We could test the sperm production hypothesis by sequencing the Y-chromosome of two gibbon species and calculating the rate of evolution of a Y-chromosome in a monogamous species. .Although I’m happy to present the test of this idea I’m not going to line up to do it, those repetitive sections of DNA make sequencing Y-chromosome so hard that it took 13 years to do the human one and 8 to finish the chimp one.

Hughes, J., Skaletsky, H., Pyntikova, T., Graves, T., van Daalen, S., Minx, P., Fulton, R., McGrath, S., Locke, D., Friedman, C., Trask, B., Mardis, E., Warren, W., Repping, S., Rozen, S., Wilson, R., & Page, D. (2010). Chimpanzee and human Y chromosomes are remarkably divergent in structure and gene content Nature DOI: 10.1038/nature08700

The Origin of Species and the origin of species David Winter Dec 31

No Comments

2009 was the double celebration for evolutionary biologists, In February we markerd the 200th anniversary of Charles Darwin’s birth and in November we celberated the 150th anniversary of That Book’s publication. Somehow I’ve managed to go the whole year without dedicating a post to Darwin’s ideas about speciation. Which is odd because I’ve spent quite a lot of thinking about, talking about and even writing about Darwin this year. So here, with about seven hours of 2009 left are a few of my thougts on Darwin and speciation.

Darwin’s book was called The Origin of Species but I’m sure that most of the tributes you’ve read to Darwin and his book this year will have focused on how he proved evolution had happened and provided natural selection as the mechanism required to explain modern organisms in that framework – the fact and the theory of evolution . Missing among the descriptions of the events that shaped Darwin’s thinking and the thousands of strands of evidence he wove to form his thesis will have been an answer to the question the title of the books seems to ask – where do new species come from. In fact, there is a prevailing view in evolutionary biology that for all his triumphs Darwin didn’t quite understand species and as a result The Origin failed to provide a theory of speciatoin. I don’t think it’s quite that simple.

To know what someone thinks about speciation you need to know what they think about species.

Practically, when a naturalist can unite two forms together by
others having intermediate characters, he treats the one as a
variety of the other, ranking the most common, but sometimes
the one first described, as the species, and the other as the
variety. But cases of great difficulty, which I will not here
enumerate, sometimes occur in deciding whether or not to rank
one form as a variety of another, even when they are closely
connected by intermediate links; nor will the commonly-assumed
hybrid nature of the intermediate links always remove the difficulty.

The Origin, p47

Darwin was the sort of person who could develop a world shattering theory, produce a body of data to support it then spent eight years looking at barnacles. Historians of science have spent a lot of ink trying to provide an explanation for “Darwin’s delay”. It may have been driven in part by an off-hand comment by his correspondent Hooker that only someone who has worked on the systematics of a group could hope to understand the nature of species or might just be a phenomenon all too familiar to modern systematists – a small project that grew out of control. Whatever the cause Darwin’s barnacle obsession (on visiting a friend’s house his son asked where his friends father “did his barnacles”) clearly shaped the way he thought about species. In numerous letters of the time, especially to Hooker, he remarks on the great deal of variation he finds within barnacles of a given species and the great trouble he finds in using that variation to define the limits of species. Partly as a result of his eight years spent dissecting barnacles Darwin came to see the variation within a species as the of the same sort as the variation that exists between species and, importantly, the difference between two varieties of a given species and two distinct species as one of degree not of kind. At the risk of boiling Darwin’s ideas down to the sort of diagram you might find in a powerpoint slide here’s a pictorial representation.

Darwin’s species concept makes the difference between species and “well marked” varieties an arbritary one. He even goes so far as to call varieties within a species “incipient species” and link the difference he noted in his barnacles, in organisms and under domestication and in organisms in the wild with the differences that seperate species and even higher orders

Hence I look at individual differences, though of small interest to the systematist, as of high importance for us, as being the first step towards such slight varieties as are barely thought worth recording in works on natural history. And I look at varieties which are in any degree more distinct and permanent, as steps leading to more strongly marked and more permanent varieties; and at these latter, as leading to sub-species, and to species.

The Origin, p51

It’s the fact that Darwin saw no fundamental difference between varieties and species that has lead many, notably Ernst Mayr, to conclude that he didn’t understand species and that The Origin was not a speciation book. I read it quite differently. To me it seems Darwin saw the term ’species’ as something a systematist could apply to a group of organisms sometime after a process he called divergence (which we would now call speciation) has started to form discontinuities between them.

The big question then is what is the process that drives the discontinuities that make for species? The clearest answer to question comes in Chapter 4 of The Origin. Here is one example of Darwin’s ideas about the principle of divergence.

It has been experimentally proved, that if a plot of ground be sown with one species of grass, and a similar plot be sown with several distinct genera of grasses, a greater number of plants and a greater weight of dry herbage can be raised in the latter than in the former case. The same has been found to hold good when one variety and several mixed varieties of wheat have been sown on equal spaces of ground. Hence, if any one species of grass were to go on varying, and the varieties were continually selected which differed from each other in the same manner, though in a very slight degree, as do the distinct species and genera of grasses, a greater number of individual plants of this species, including its modified descendants, would succeed in living on the same piece of ground. And we know that each species and each variety of grass is annually sowing almost countless seeds; and is thus striving, as it may be said, to the utmost to increase in number. Consequently, in the course of many thousand generations, the most distinct varieties of any one species of grass would have the best chance of succeeding and of increasing in numbers, and thus of supplanting the less distinct varieties; and varieties, when rendered very distinct from each other, take the rank of species.

The Origin, p88

In typically prescient fashion Darwin took a proto-ecological view to the experimental evidence that plots sown with multiple plant species where more productive than monocultures. If the the mixed-species plot is doing better than the monoculture it must mean each species is taken advantage of different resources in that plot – what we’d now call distinct ecological niches. But then he took it yet further. What would happen if we let that monoculutre grow on for several generations. We know from his barnacles and from all the examples he listed in the previous chapters of The Origin that variants will arise. A very few of those variants will be able to make use of some of the resources that were previously going untapped. Over many generations natural selection would act – the most specialised forms would produce more seeds and produce more variants while forms intermediate between the ancestral species, not being masters of either niche, would be out competed and driven to extinction. Let this process continue long enough and you’d get first new varietes and finally, since they are just very distinct varietes, new species. Darwin provides his own diagram (the only one in the book) to describe this process and its phylogenetic implications but that is, in my supervisor’s words, “a rattly looking thing” so here’s one from me.

After the rediscovery of the Mendelian genetics and the forging of the modern synthesis we’ve come to see that some of Darwin’s ideas about species and speciation are too simplistic. The verbal argument presented above in which new species are formed solely by natural selection doesn’t hold up to modern mathematical scrutiny – recombination between unlinked genes will break down the distinction between forms more quickly than selection can makes the difference. Modern models of speciation which come strong natural selection with assortative mating do produce new species and a number of emperical studies seem to suggest this has happened in the wild.

I find it very hard to marry the received wisdom that Darwin failed to understand the nature of species and provided on theory of speciation with the arguments Darwin presented in The Origin. When his species concept is viewed (as I think all such concepts should be) as a diagnostic tool rather than an essential definition then his is as good as any other. His theory of speciation as presented doesn’t hold up to our modern knowledge of genetics but the underlying process, selection driving ecological specialisation, forms one half of our modern models of speciation that don’t involve geographical isolation and those that involve secondary contact between incipient species.

Some updates David Winter Oct 27

No Comments

Some new developments in stories that have appeared in these pages:

Marsden Fund 2009: When Family Trees get convoluted David Winter Oct 08

No Comments


2009 has seen the 200th anniversary of Charles Darwin’s birth and the 150th birthday of the book that changed everything. 172 isn’t quite as round a number as the other two but as we celebrate Darwin’s bicentenary the we should remember July 1837. Sometime in that month Darwin opened his brown notebook, wrote the words “I think” on the top of a page and drew his very first phylogenetic tree. Over the next 10 or so pages (you can read them here) Darwin scrawled out the implications of the big idea contained in that tree – that both the diversity seen in modern species and the continuity of form seen between them might be explained by ancient species splitting to from distinct lineages, changing and splitting again. Life as a branching tree.

It says something about Darwin that having for the first time sketched out his idea he didn’t end with a hot blooded exclamation like Eureka! Instead he wrote cuidado – be careful. In fact, it took him 22 years of cautious letter writing and careful barnacle inspection (and one hell of a fright in a letter from Wallace) to publish The Origin. That book contained one illustration – a phylogenetic tree. In subsequent years the Tree of Life has become the central metaphor for Darwin’s view of life and recovering the relationships between organisms has become a major part of how we do evolutionary biology. New Zealand mathematicians have been among the leaders in providing biologists with the tools to produce phylogenetic trees and an understanding of how they might be best applied. This year the Marsden Fund has given grants to three projects looking at how to recover trees from the murkiest evolutionary histories.

Well resolved phylogenies help us to test evolutionary hypotheses – are New Zealand’s plants and animals relicts from Gondwana? Is Sphenodon guntheri really a distinct species of tuatara? Do kiwis descend from flying birds?* To put these sorts of questions to the test we need to estimate relationships between organisms, usually by reconstructing relationships between DNA sequences from them. In most cases these ”gene trees” are good proxies for the species trees we want to know about, but this biology so there are exceptions to the rule. Quite a few processes occur in populations and within genomes that drive gene trees away from species trees.

Charles Semple’s project “unravelling the web of life” attempts to account for the fact the as well as being passed from parent by offspring genes can jump from one species to another. Although we’ve known that such Horizontal Gene Transfer (HGT) is possible since the 60s it’s only more recently that it’s become increasingly clear that att the very base of the tree of life the degree of HGT was so great the tree metaphor with it’s simple one into two branching pattern breaks down, the tree becomes a tangled web. HGT is not limited to the base of the tree of life either, micro-organisms continue to swap genes with each other and your own genome contains quite a lot of virus DNA, inserted into your ancestor’s genome to get the ancient viruses multiply and passed on to you. Semple’s project aims to provide the same sort of mathematical basis we have for understanding tree like evolution for the much more complex pattern we see in evolutionary histories that include HGT.


James Degnan’s project moves from the root of the tree of life to the tips. When the the process that forms new branches on trees, speciation kicks of each of the nascent species will inherit a suite of genes, each of which has its own history (the same lineages I’ve written about with respect to my mitochondria). If we try and infer species level relationships from just one gene’s tree we fall into all sorts of problems, especially if we are dealing with recent or rapid speciation.(there are even genes that would place Gorillas as humans closest living relatives). Degnan has already worked on one of a bunch of programs avaliable to infer species trees from multiple gene trees and his “fast start” Marsden grant will allow him to keep working this field.

It’s not just strange genetic quirks that strain Darwin’s metaphor of tree like evolution. In plants, and at least some animals speciation sometimes occurs following hybridisation – two barnches into one. Even hybridisation isn’t making new species it’s a force that can provide conflicting phylogenetic signals to sequence data . Barbara Holland’s grant for “Untangling complex evolution: when the Tree of Life is not a tree at all” will help to make better methods for revealing these kind of complex evolutionary histories and help biologists know when recovering the One True Tree for a groups isn’t a sensible goal.

*The answers are “mostly not”, “no” and “almost definitely”

My mutant mitochondria and life on earth David Winter Jul 31

No Comments

You may know Damian from conversations at Ken’s and various places that approach similar questions. You should probably go read his blog because it’s interesting and, frankly, he’s desperate for the traffic. A while back Damian was thinking about mitochondria and what they can tell us about people. Like any good scientific pedant I turned up and picked holes in specifics of what Damian had to say but provided nothing comparable to the message he was trying to provide. So now, only three months after Damian provided his thoughts on mitchondria, here’s a few of thoughts on my own mitochondria, the dark secret each one holds and why that secret is the key to understanding just about everything in biology.

But, before I out myself to the world I should perhaps talk about just what a mitchondrion is. At it’s most basic level all life is a very special set of chemistry, our cells are chemical factories making the materials from which we are built and running the reactions that keep us ticking over. 1 The cells of complex organisms like you, me and slime molds can run thousands of different chemical reactions at the same time without the products of each reaction interfering with each other because we have structures called organelles (yes, small organs) that effectively wall off one bag of chemicals from the rest of the cell. Mitochondria are the organelles that make energy  for the rest of the cell’s activities. Which really ought to be reason enough to celebrate them in a blog post, but as an evolutionary biologist I have another reason to venerate mitochondria. In animal and fungal cells mitochondria are the only structure outside of the the nucleus that contain their own DNA and in most animals that DNA (which I’m going call mtDNA from now on) is passed from mothers, and not fathers, to offspring (analogous to the way surnames pass from fathers and not mothers). To me a mitochondrion is not only a source of cellular energy but an independent witness to the evolutionary history of its host.

So, what can this extra set of genes tell us? When I was an undergrad I spat in a falcon tube, extracted DNA from the check cells that I had floating around in my mouth and amplified some of my own mtDNA then sent the sample away to have its sequence of chemical bases read and converted into a sequence I can read: 

AAGGAACAATCAGAGAAAAAGTCTTTAACTCCACCATTAGCACCCAAAGCTAAGATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCC
AAGTATTGACTCAGCCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACAATAAATACTTGACCACCTGTATACATAAAAACC
CAATCCACATCAAAACCCCCTCCACATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGCCACCCCTCACCCATTAGGATACC
AAACAAACCTACCCACCCTTAACAGTACATAGCACATAAAGCCATTTACCGTACATAGCAACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAG
GGGTCCCTTGACCACCATCCTCCGTGAAATCAATRATCCCGCCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAACACTTGGGGGTACGCTAAAAGTGAACTGTATCC
GACAATCTGGTTCCTACTTCAGGGGCCATAAAGCCTAAATAGACCCACAACGTTCCCCCTTAAATAAGACCATCACGATGGATCACAGGTCTATCACCCTATTAAACCACT
CACGGGGAGCTCTCCATGCATTTGGGTATTTCGTACCTGGAGGGGGTATGCACGCGGATAGCATTGCGAGACGCTGGAGCCGGAG

There it is then, highlighted in blood red, my dark secret. The prosaic explanation for that bright red ‘R’ amongst the ‘A’s ‘T’s’ C’s and ‘G’s is that the sequencer couldn’t decide if I had a ‘A’ or a ‘G’ in that position. On closer inspection it turned out I had both – some of my mitochondria have ‘A’s, some ‘G’s. Somewhere in the line of mothers and daughters that lead to the source of my mitochondria, or in my Mum, or possibly even sometime during my early development an error was introduced to one mitochondrion’s DNA and over time that error was copied so many times that by now it’s present in about half of my mitochondria. That is to say, I am a mutant.

Perhaps I’m being overly dramatic. The region of mtDNA that I sequenced doesn’t make a protein, it’s not quite junk DNA but the particular DNA base at the highlighted red position probably has no discernible effect on the way my cells work. Our typical conception of mutation is drawn from the tragic effects of those relatively rare mutations, induced in our bodies or passed on through germ cells, that lead to diseases (or, in movies to super powers). In fact, we are, each of us mutants. DNA replication is not perfect, we are born with about 6 or 7 new mutations [err, I was out by a factor of 20 there, more like 100-200 mutations...]in our nuclear genome and the mitochondrial genome mutates much more quickly than that. One of the revelations of evolution biology in the molecular age has been the realisation that most mutations are like the one I’ve revealed to world – of little or no effect. They occur in regions of the genome that don’t have genes or if they are in genes they don’t alter that gene’s product or even they do alter the product the difference is so slight the end result is undetectable. Only a few mutations have devastating effects, an even smaller minority actually make live easier for their host.

At first glance the genuinely silent majority represented by ‘neutral mutations’ might seem a more boring topic than their deleterious and advantageous counterparts ( the molecular basis of, respectively, disease and natural selection). In fact, because neutral mutations behave in predictable ways within populations the development of a neutral theory of molecular evolution has allowed us to test a lot of ideas in evolutionary biology. Let’s look at an example. In each generation every individual has a small chance of having a mutation in at each of their DNA bases, we call this the mutation rate (µ). This means in a population new mutations arise at a given base at the individual mutation rate multiplied by the population size (N). What happens to these mutations once they get into populations? If they are selectively neutral they won’t effect their host’s chance of reproducing so it will come down to chance – if the mutation arises in a particularly fecund individual there will be lots of copies of the mutation in the next generation, if our mutant is struck by lightning before they reproduce the mutation will go extinct. As long as the mutation survives its frequency in subsequent generations will bounce up and down with no particular direction but in the long run finite population sizes mean there are only two fates for mutations, they go extinct or they completely take over the population (become fixed in population genetics parlance). We can calculate the probability that a new mutation becomes fixed rather than lost, it’s 1/N. Where did I pull that from? A population genetics model called the coalescent might help to explain why this is true.

Take a very small population, six individuals:

Now, let our six individuals live every teenagers’ dream and choose their parents. Since we are talking about neutral mutations we can do this at random, so throw six dice. My results (in order) were 1, 2, 2, 3, 3 and 6 so we can connect our offspring to their their parents:

You might be wondering what kind of trick I’m up to here, offspring don’t choose their parents and even if we are doing it at random aren’t we going backwards? Yes, but that’s fine. We are not describing populations, we’re making a model to help us understand how they work. Saying that each child has a 1/6th chance of we’re being the offspring of each parent (and deciding that with a die) is exactly the same thing as saying each potential parent has a 1/6th chance of being the parent of each member of the next generation. So, even if offspring choosing their parents is biological nonsense it’s a useful way of understanding real biology. With that out of the way lets look at our parental generation, the 4th and 5th individuals didn’t reproduce. I’m sure the led rich and full lives and contributed to society in many interesting ways but at the moment we’re interested in how we ended up with our current population, so lets discard them then simulate a few more generations, ignoring individuals that didn’t contribute to the last generation:

Ha! Our lineages have coalesced. In fact, I shouldn’t be surprised because every lineage for every gene in a population will eventually coalesce at a single common ancestor (called the most recent common ancestor or MRCA). There is a MRCA for all human mitochondrial lineages, kiwi evolutionary biologist Allan Wilson named her mitochondiral eve which I’m sure he thought was very clever at the time but has since led many people to that mtEve was, in every way, like her biblical counterpart. You can see from our little simulation that she need not have been the only human on earth and, in fact, there were other people alive at the same time as mtEv who also have modern descendants (because eve is only the MRCA of the matrilineal line). Moreover, in large populations the title mtEve can only be bestowed on someone who has been dead for many, many generations and in subsequent generations as lineages die out, the title will pass on to someone else.

Let’s leave Eve for the time being and return our focus to our population of circles. Think about what the inevitability of coalescence means for new mutations. Each individual in generation 5 will either be the ancestor of all the individuals in the present generation or none of them. Under the neutral model those eventualities are decided at random so the chance that any gene (including a new mutant) becomes the MRCA as some later stage really is one over the population size – 1/N.
Now we have a term that describes the rate at which mutations arise and another that tells us how likely they are to be fixed once they have. From here it one tiny step to work out the rate at which new mutations will be fixed (k) in a real population: 

 k = (µ x N) x 1/N

And we can get rid of the population size in a puff on third form algebra:


k =  (µ x N) / N
  =  µ

That is, new neutral mutations are fixed in populations at a constant rate equal to the population mutation rate (and not effected by population size). Of course the individual mutation is probabilistic, so the ‘constant’ rate is in fact the cumulative adition of discrete events meaning the actual number of mutations fixed in a given population at a given time will vary around the expected value. Having an idea of how a real population behaves in the absence of selection provides evolutionary geneticists with a null hypothesis
to test for selection. Let’s look at some real data from a the human and chimp genome projects. You may already know that most of the DNA in mammalian genomes is not actually made into a gene product – even in the regions of genome that actually make proteins are flanked by “untranslated regions” (UTRs) that are required for the gene to work but don’t code for part of a protein2. Ryuichi Sakate and colleagues compared the rate at which mutations have been fixed in the coding regions and the UTRs of genes in either the human or chimp genome since we parted ways with our cousins 
graphed with the wicked GGPlot library for R

As you can probably see mutations are fixed signifcantally more frequently in the UTRs of the genes than they are in the coding sequence (an effect that is slightly masked by the fact that translated regions are smaller than coding sequences so are more likely to have no mutations at all). Remember, that our neutral model tells us that mutations are fixed at a rate equal to the individual mutation rate. There is no reason to believe that the mutation rate of UTRs is any greater than that of the coding region that they are associated with so the the fact less of less those mutations are getting fixed must be down
be differences in the survival of those mutants – natural selection. In fact, in this case we have good evidence for ‘purifying selection’ weeding out deleterious mutations in the coding regions of genes with a more permissive selection regime in the UTRs since mutations ocuring here can’t effect the sequence of the protein that the gene produces.

Even in the coding region only a subset of mutations can change the protein sequence so we can further classify the mutations in Sakate et. al’s study into ’silent mutations’ that don’t change the protein sequence (dS) and ‘non-silent mutations’ (dN) which do change the protein. Due to the nature of the genetic code we’d expect silent and non-silent mutations occur at about equal rates. When you look at the inset of the graph above you find that, for these genes at least, silent mutations are much more likely to be fixed than non silent ones. Again, this is good evidence that we have purifying selection, most of the non-silent mutations that occur in the coding regionsare being selected against. This probably shouldn’t come as a great surprise, after all our genes are the results of round upon round of natural selection – they are already pretty good at what they do so any change is likely to make the protein worse 3. What’s important is that the very simple things we deduced about mutations above allows us to understand how natural selection has worked in the human genome.

Or am I pulling a fast one? The analysis above depends on the idea that humans and chimps once shared a common ancestor and as well all know that is a wildly speculative hypothesis based on tenuous extrapolation from a few partial fossils and a lot of wishfull thinking from people whose faith in atheism is so great they need to banish a creative spirit from their lives. Or perhaps not. Think back to our population of circles, the key message from that simulation was that within a population mutations are fixed at a constant rate. The generation of new species, which we call speciation, is the splitting of a single population into two distinct lineages that no longer share genes.

During and after speciation, each new species will start accruing new mutations independently and, for neutral mutations, at a constant rate. As the new species continue on their new trajectories their DNA sequences will become progressively more distinct from each other as they independently fix mutations. We can use this information to discover relationships between species. Let’s go the The Big Gene Database and get some sequences that match a subsectin of my mitochondrial DNA:

me        CATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAG
chimp     CATTACAGTCAAATCCATCCTCGCCCCCACGGATGACCCCCCTCAGATAG
gibbon    CATCCCAGTTAAATC-ATCCTCGTCCCCACGGATGCCCCCCCTCAGATGG
monkey    CATATTCATTAAATA-ATCCTCTTCACCACGGATGCCCCCCCTCACTTAG

Now, calculate the proprtion of sites which are different between each sequence:

me
0.082 chimp
0.163 0.122 gibbon
0.306 0.265 0.224 monkey

So, the smallest difference is between me and the chimp. If you keep doing this process, but now recording thepercentage difference between either my sequence or the Chimp one against the Gibbon and Old World Monkey sequence you find that the Gibbon is more similar to the human-chimp group than it is to the Old World Monkey sequence. We can represent these relationships with a a tree (which might make this blog’s  logo make sense to you):

This result is the antidote to people that make the claim evolutionary biologists are simple comparing ’similarity’ when we estimate the relationships between species. Here we have used a simple model of the way in which sequences change and applying that to the sequences we have to work out the relationship which most easily predicts the differences between those sequences. In actuality our model is overly simplistic (for instance certain DNA changes are more likely to happen than others so we can’t use raw percentage difference between sequences) and using only 50bp of DNA to estimate relationships is unlikely to get you published in Nature.The best evidence that the phylogeny produced above is the eight one is the fact independently lines of evidence (unlinked genes, morphology, geography, behaviour) support it.

There is one last thing that we can work out from our DNA sequences and what we know about population genetics. If we can put a date on one of the branching points on the tree we can actually estimate the time for all the other splits. As is happens we know that the oldest Old World Monkey fossil to be discovered is around 15 million years old, meaning the latest that first branch that splits the apes (me, the Chimp and the Gibbon) from the monkey sequence could have happened is 15 millions years ago. The average difference between the monkey sequence an a ape one is 0.265 – which divided by 15 million years gives us substitution rate of around 0.018 bases per million years. If we apply this rate to observed distance between human and chimp sequences (0.082 changes per base /0.018 base changes per million years) you get an estimate of the age of the split at around 4.5 million years. When you do the same analysis on more than 50 bases of DNA you normally end up with a bunch something more like 5-7 million years.

Sadly my mutations is, from an evolutionary perspective, effectively dead. Males don’t pass on their mitochondria so that mutation will die with me. Still, as I said each carry our own set of private mutations – wouldn’t it be nice to think one day a variant that started as something unique to you made it so far through humanity that it could be used to keep track of the way natural selection continues to act on our species and even to help us find our place in the biosphere?

1. Creationists, this a literary device known as “metaphor”, please move along
2. There are also regions called introns that are spliced out of genes before they moce off to be translated, but we’ll focus on the UTRs here
3. There are genes, even in this dataset, for which there is evidence for positive selection – mutations being fixed more quickly than you’d expect under neutrality – which is the basis of adaptatoin to local environmental conditions. But in the main most selection is purifying.

Autumn in Dunedin David Winter May 24

No Comments

I thought I’d kick things off at the new place with something a bit older, a piece I wrote a few autumns ago but never let see the light of day. The photos are from a few days ago

Autumn in Dunedin Autumn in Dunedin

Dunedin’s all too short a lease on summer is running out. The bare chested, beer guzzling boys that made Castle Street their cricket pitch have found hoodies, high school leavers jerseys and rugby balls. Students they have been around Dunedin long enough to know are reconciling themselves with the city’s slide into a winter of cold dark mornings followed quickly by cold dark evenings. Even the trees around campus are hunkering down. . The chemical cascades that ran wild in leaves through the summer to capture the sun’s energy are grinding to a halt. Keeping these reactions going through the winter would cost more energy than they could generate so the leaves, like middle management closing down an unprofitable branch, let the leaves fade and fall.

The autumn displays that deciduous trees put on are rightly held up as an example of the great beauty in the natural world. Until recently the scientific understanding of these displays has been entirely more prosaic. The green, light catching pigment chlorophyll is hard to make and as such a valuable resource for a tree. Before the tree cuts its leaves free it strips their assets – taking all the chlorophyll out to reinvest it in the next season’s crop. With the very green chlorophyll removed red and brown pigments (always present but previously swamped by the chlorophyll) shine through and you get autumn colours. However, over the last few years another theory has challenged this idea and enlivened scientific interest in the phenomena occurring around Dunedin at the moment.

The new theory is among the very last from W. D. Hamilton, one of the 20th century’s greatest biologists. When Hamilton died in 2000 he was eulogised as “the most distinguished Darwinian since Darwin” and generally lauded for the way his insightful, almost whimsical (he once proposed clouds were generated by bacteria as a way of spreading themselves) ideas revolutionized biology. Hamilton was a key figure in a generation of English biologists that sought to describe almost everything in nature, including humans and our behaviour, as the result of evolution by natural selection and in so doing formed the ‘adaptationist school’ of evolutionary theory. Hamilton’s greatest contribution to this effort was to show that seemingly altruistic behaviour by an organism towards its relatives (including parental care) can be explained in terms of natural selection acting at the level of genes. This theory formed an important part of Richard Dawkins’ bestselling popularisation The Selfish Gene

Later in life Hamilton focused on another evolutionary mystery. Sexual reproduction seemed counterproductive in the genetic understanding of evolution he had helped to usher in. If each individual is acting to maximise the amount of genetic material it passes to the next generation then putting only half of your genes into each child and having half of those offspring themselves unable to bear more young (that is to say being male) seems a silly idea. As Hamilton’s colleague John Maynard Smith pointed out sexually reproducing organisms must reap some evolutionary advantage over asexually reproducing ones or evolution would favour a return to asexuality (as has happened in many lineages). Hamilton believed that sexual reproducing organisms may be reaping that reward in the constant and expensive wars they wage with parasites. By mixing their genes with each other organisms may be able to make novel weapons in that fight that asexual clones couldn’t arrive at. The first support for this idea from nature came from lakes right here in New Zealand’s South Island. The tiny snails you find clinging to rocks in our lakes are a perfect model in which test Hamilton’s ideas because they are heavily parasitized in some areas and not in others and because some lineages reproduce sexually and others have given up on that idea and reproduce by cloning. In 1987 Curt Lively showed that sexually reproducing snails occurred where parasitisation was at its densest while asexual ones survived in higher numbers where parasitism was low. This is exactly what Hamilton’s theory predicts – sexually reproducing lineages are gaining an edge in parasite heavy lakes while asexual lineages prosper when they don’t have to fight many parasites

Much of Hamilton’s later worked centred on important the role of parasites in evolution, he went so far as to suggest they may explain the peacock’s ostentatious tail. He theorised that only males that were free of parasites and by extension healthy could invest in such elaborate displays. Shrewd peahens would therefore select partners with the most over-the-top tails to ensure their offspring got the best parasite fighting genes. In other words, to Hamilton a peacock’s tail was a gawdy advertisement for its owner’s genes.

He even thought parasites might explain autumn colouration. In a paper published posthumously in the Proceedings of the Royal Society of London Hamilton argued that deciduous tree’s autumn displays might represent an advertisement similar to a peacock’s. In his theory autumn colours are actually a tree’s way of telling parasitic insects that the tree is so healthy it can stop photosynthesising early and invest in bright red and yellow colouration as a warning. A tree that is strong enough to give up it’s energy making process early must surely be strong enough to invest in the many measures trees take against their parasites so a prudent insect will stay well clear of such a tree when it some time to lay its eggs.

One of the hallmarks of a good scientific theory is testable predictions. Hamilton’s signalling hypothesis makes several predictions, many of which are gaining experimental support. First, if the yellow and red leaves are indeed a signal to be taken seriously by potential parasites then we would expect only healthy trees could invest in colouring their leaves at the time the parasites arrive. One good marker for the health of a tree is how symmetrical that tree’s leaves are – healthy trees produce nice symmetrical leaves while trees under stress make more irregular ones. In 2003 Norwegian researchers took yellow and green leaves from birch trees in early autumn. According to Hamilton’s theory only the healthy trees will be investing in yellow leaves so, on average, the yellow leaves will be more symmetrical. When the researchers measured the leaves this is exactly what they found.

If autumn colours are a signal for insects and they would need to be made when infection by parasitic insects was likely. Swiss researchers confirmed in 2004 that deciduous trees in that country change colour when aphids start to lay eggs (which will hatch in spring when the trees produce sugar rich sap) Thirdly, if the signal is actually heeded by insects we would presume those aphids in fact steered clear of the trees making the strongest displays and picked the ones that were still green. The same Swiss team and a number of other investigators have reported that aphids show a strong preference to laying their eggs on green leaved trees. Finally, and most obviously, Hamilton’s theory also suggests that the healthy trees that invest in signals suffer less at the hands of parasites in the following spring. This prediction was born out in 2003 Norwegian study.

All this speaks strongly for the veracity of Hamilton’s signalling hypothesis. Still, a great number of scientists remain sceptical and number of related and unrelated theories has been proposed in response to Hamilton’s. Which ever theory turns out to be true Hamilton’s signalling hypothesis is one of the last gives from one of the greatest minds in biology. He took one of the most mundane stories in biology – fiscal dowdiness on the part of trees – and enlivened it. In Hamilton’s view the hills around Dunedin are on fire with warning shots from and evolutionary cold war, a fine example of how a little insight to the workings of biology can add yet more beauty to the natural world.

Sadly, it seems Hamilton’s theory may be, in the word of TH Huxely, “that great tragedy of Science – the slaying of a beautiful hypothesis by an ugly fact”. Check out what Carl Zimmer (whose blog put me on to this story in the first place) has to say on it.